Skip to content

Cl Amidine Synthesis Essay

Abstract

Protein arginine deiminases (PADs) catalyze the post-translational hydrolysis of arginine residues to form citrulline. This once obscure modification is now known to play a key role in the etiology of multiple autoimmune diseases (e.g., rheumatoid arthritis, multiple sclerosis, lupus, and ulcerative colitis) and in some forms of cancer. Among the five human PADs (PAD1, -2, -3, -4, and -6), it is unclear which isozyme contributes to disease pathogenesis. Toward the identification of potent, selective, and bioavailable PAD inhibitors that can be used to elucidate the specific roles of each isozyme, we describe tetrazole analogs as suitable backbone amide bond bioisosteres for the parent pan PAD inhibitor Cl-amidine. These tetrazole based analogs are highly potent and show selectivity toward particular isozymes. Importantly, one of the compounds, biphenyl tetrazole tert-butyl Cl-amidine (compound 13), exhibits enhanced cell killing in a PAD4 expressing osteosarcoma bone marrow (U2OS) cell line and can also block the formation of neutrophil extracellular traps. These bioisosteres represent an important step in our efforts to develop stable, bioavailable, and selective inhibitors for the PADs.

Introduction

Protein arginine deiminases (PADs), members of the amidinotransferase superfamily of enzymes, catalyze the hydrolysis of arginine residues to form citrulline (Figure ​1).1−3 There are five PADs (PAD1, -2, -3, -4, and -6) in humans and other mammals.1−3 These enzymes are highly related with 50% interisozyme sequence identity and require micromolar levels of calcium for full activity; calcium binding causes a conformational change that allosterically activates the enzymes.1−3 Although highly related, these enzymes display unique tissue distribution patterns. For example, PAD2 is expressed in most tissues and cell types, whereas PAD1 and PAD3 are generally restricted to the skin and hair follicles and PAD4 and PAD6 are primarily expressed in neutrophils and oocytes, respectively.3 Although we are only beginning to understand how the PADs contribute to normal human physiology, it is known that these enzymes help control myelination, differentiation, the epigenetic control of gene transcription, the innate immune response, and the maintenance of pluripotency.4,5 In addition to these processes, dysregulated PAD activity is associated with the onset and progression of multiple inflammatory diseases (e.g., rheumatoid arthritis, multiple sclerosis, lupus, inflammatory bowel disease, and ulcerative colitis) and also some forms of cancer.3,6−14

Figure 1

Protein arginine deiminases (PADs) convert arginine residues into citrulline.

Although it is not understood how the PADs contribute to such a disparate number of diseases, common links include their role in controlling the formation of neutrophil extracellular traps (NETs) as well as their ability to modulate the expression of both proliferative and antiproliferative genes.15,16 The overwhelming evidence linking dysregulated PAD activity to disease pathogenesis prompted the initiation of several PAD inhibitor programs.17,18 Prior work in this area includes the identification of several reversible PAD inhibitors (e.g., Taxol, methylarginines, and minocycline); however, these compounds are very weak PAD inhibitors or have multiple off targets.19−27 As such, they have shown limited utility as tool compounds to study PAD biology. By contrast, the haloacetamidine class of compounds has provided key insights into PAD biology.17,18 Cl-amidine, the most widely used member of this compound class, has been used to demonstrate PAD involvement in the maintenance of pluripotency, the epigenetic control of gene transcription, and the formation of neutrophil extracellular traps.16,28−32 Additionally, Cl-amidine shows efficacy in multiple preclinical models of autoimmunity and cancer including ulcerative colitis, lupus, rheumatoid arthritis, and atherosclerosis as well as breast cancer.12,33−41 To enhance the potency, selectivity, and bioavailability of Cl-amidine, we and others have generated a number of derivatives including TDFA (a tripeptide F-amidine analog) and YW3-56.12,42 However, these compounds are all peptide based and subject to degradation by proteolysis. This is even the case for Cl-amidine (Scheme 1) because the basic chemical scaffold (i.e., benzoyl arginine amide, BAA) is a trypsin substrate.

Scheme 1

C-Terminal Bioisosteric Modification of Cl-amidine

Recently, we synthesized a series of d-ornithine based compounds hypothesizing that these analogs would be more stable relative to their l-amino acid counterparts.43 Although subsets were potent PAD inhibitors, d-amino acid derivatives showed only minor improvements in their overall stability. In our continuous efforts to identify stable, potent, and selective inhibitors for the PADs, we describe herein, the design, synthesis, and biological evaluation of tetrazole analogs of Cl-amidine.

Results and Discussion

Chemistry

Given that tetrazoles are bioisosteres for carboxylic acids and cis/trans amides,44−46 we hypothesized that the replacement of the C-terminal amide bond in Cl-amidine with a tetrazole ring would improve the stability of the parent compound. Notably, the tetrazolium ring tends to be ionized at pH 7.4, exhibiting a pKa value of 4.9, thereby mimicking the electronegativity of the C-terminal carboxamide. The synthesis of these tetrazole based analogs began with the corresponding Bz-Orn(Boc)-amide (Scheme 2). The C-terminal carboxamide was dehydrated with triethylamine and TFAA to give the corresponding cyano compound. The cyano ornithine was then heated with sodium azide in iPrOH/H2O to generate the tetrazole. Deprotection of the Boc protecting group with TFA led to the formation of two products in one pot: the desired tetrazole and a tetrazole tert-butyl derivative. The attachment of a tert-butyl group onto a highly acidic tetrazolium ring during the course of Boc cleavage with TFA has precedence in the literature.47 Note that these substituted tetrazoles are no longer acidic because of substitution of the acidic nitrogen. The tetrazole and tetrazole tert-butyl derived ornithines were separated by HPLC, and then the chloro- and fluoroacetamidine warheads were installed using standard protocols.48 Purification yielded a series of tetrazole derived haloacetamidines in good yield (68–78%) (Scheme 2).

Scheme 2

Synthesis of Tetrazole Analogs of Cl-amidine and F-amidine

With the tetrazole chemistry in place, we next considered that replacement of the N-terminal benzoyl group with a biphenyl benzoyl moiety would increase the hydrophobicity of the compound to enhance cellular uptake. To this end, the commercially available H2N-Orn(Boc)-OH was treated with 4-phenylbenzoyl chloride to give biphenyl benzoyl ornithine which was converted to the corresponding amide. The amide was then further converted to the corresponding tetrazole and tetrazole tert-butyl ornithine derivatives using the methodology outlined in Scheme 3. The warheads were then attached to the individual ornithine to give another set of compounds in good yield (>68%).

Scheme 3

Synthesis of Biphenyl Tetrazole Analogs of Cl-amidine and F-amidine

Since o-Cl-amidine and o-F-amidine are highly potent PAD inhibitors,35 we anticipated that the attachment of an o-carboxylate on the phenyl group at the N-terminus of the tetrazole based compounds would also enhance compound potency and selectivity for the PAD isozymes. The synthesis of o-carboxylates began with Fmoc-Orn(Boc)-amide which was converted to the corresponding tetrazole compound in two steps (Scheme 4). The Fmoc group was then cleaved with 20% piperidine in DMF, and the resulting compound was treated with phthalic anhydride in THF at room temperature to install the o-carboxylate on the phenyl ring. The Boc group was then cleaved with TFA, which afforded the tetrazole and tetrazole tert-butyl ornithines in good yield. The chloro- and fluoroacetamidine warheads were then installed to give the desired o-carboxylate tetrazole derivatives (Scheme 4).

Scheme 4

Synthesis of o-Carboxylate Containing Tetrazole Analogs of Cl-amidine and F-amidine

Compound Potency and Selectivity

With the tetrazole analogs in hand (47, 1114, 1922), we next evaluated their potency and selectivity by determining kinact/KI values for PAD1, -2, -3, and -4. kinact/KI is used because it is the best measure of potency for an irreversible inhibitor. PAD6 was not tested because it shows no in vitro activity. Notably, the highest potencies and selectivities were obtained for the o-carboxyl-containing tetrazoles (Figure ​2, Table S1). We have previously reported that the installment of a carboxyl group ortho to the N-terminal amide increases potency,35 likely because of the formation of favorable H-bonding and/or electrostatic interactions between the o-carboxylate and W347 and R374.35 For Cl-ortho tetrazole (19), the kinact/KI values are 82 000 and 159 000 M–1 min–1 for PAD1 and PAD4, respectively. Cl-ortho tetrazole (19) also showed 15-fold selectivity versus PAD2 and PAD3. F-ortho tetrazole (20) was similarly potent for PAD1 and exhibits 20- to 30-fold selectivity over PAD2 and PAD3 when compared to PAD1. Interestingly, the use of the fluoroacetamidine warhead significantly reduces the potency of this compound toward PAD4, indicating that significant selectivity can be achieved by altering the identity of the warhead. Moreover, introduction of the tert-butyl moiety further altered the selectivity of the remaining compounds. For example, both Cl-ortho tetrazole tert-butyl (21) and F-ortho tetrazole tert-butyl (22) show a significant improvement in their ability to inhibit PAD2. This trend was observed for the other tert-butyl derivatives described herein. For example, the kinact/KI values of tetrazole tert-butyl Cl-amidine (6) and tetrazole tert-butyl-F-amidine (7) for PAD2 are 7500 and 6500 M–1 min–1 versus 1200 and 380 M–1 min–1 for Cl-amidine and F-amidine, respectively. In a similar fashion, the biphenyl derived tetrazole tert-butyl compounds possess higher selectivity toward PAD2. For example, tetrazole tert-butyl-F-amidine (7) and biphenyl tetrazole tert-butyl-F-amidine (14) preferentially inhibit PAD2 by 3- to 25-fold with the highest selectivity being observed for PAD2 over PAD4. It is important to note that both compounds 7 and 14 are highly selective PAD2 inhibitors relative to the other PADs. The preferential inhibition of PAD2 suggests that the fluoroacetamidine warhead is more suitably oriented within the PAD2 active site. Note that since saturation was not observed in the plots of the pseudo-first-order rates of inactivation versus concentration of inhibitor, it is difficult to ascertain whether the different potencies of the compounds toward the different isozymes are driven by effects on the reactivity of the electrophile (i.e., kinact) or differences in the inherent binding affinity of the inhibitors (i.e., KI).

Figure 2

Selectivity of tetrazole haloacetamidines: (A) selectivity of tetrazole analogs of Cl-amidine; (B) selectivity of tetrazole analogs of F-amidine.

Cell Viability Studies

To examine the antiproliferative activities of these tetrazole analogs, we next evaluated their ability to inhibit the growth of U2OS cells using a fixed concentration of inhibitor (i.e., 20 μM) (Figure ​3A and Figure ​3B). Cell viability was assessed with the colorimetric XTT assay. Impressively, biphenyl tetrazole tert-butyl Cl-amidine (13) completely abolished cell growth at 20 μM. Biphenyl tetrazole tert-butyl-F-amidine (14) also inhibited cell growth, although the effects of this compound were markedly attenuated (more than 50% of cells are viable when cells were treated with 20 μM of the fluoro analog) (Figure ​3B). The remaining compounds showed no effects on cell viability at this concentration. To provide a more direct measure of the cellular potency of our two best compounds (13 and 14), we determined the concentration of compound that reduced cell viability by 50%, i.e., the EC50 value (Figure ​3C). Consistent with our initial screening data, the EC50 of compound 13 (10 ± 2.5 μM) was significantly better than the value obtained for compound 14 (EC50 = 45 ± 1.2 μM). Importantly, the EC50 values are 16- and 3.5-fold better than those obtained for the parent compound Cl-amidine (EC50 = 160 ± 20 μM). This improved cellular efficacy is likely due to the increased hydrophobicity of the biphenyl compound enhancing cell penetration. Although the o-carboxyl containing tetrazoles are very potent in vitro PAD inhibitors, the presence of the negatively charged carboxyl group likely reduces their overall bioavailability. Overall, these data highlight the potential utility of targeting the PADs for the development of an anticancer therapeutic. This is especially true for the fluoroacetamidine containing compounds because the inherent reactivity of this warhead is quite low and shows few off targets.49,50 We do note, however, that for the chloroacetamidine containing compounds, it is difficult to directly link their cytotoxicity to PAD inhibition versus an off target effect. We are currently using these scaffolds to develop next generation activity-based protein profiling reagents to address this possibility.

Figure 3

Cell efficacy studies. (A) Cell viability studies with the tetrazole analogs of Cl-amidine. U2OS cells were treated with compounds at final concentration of 20 μM, and cell viability was measured by the colorimetric XTT assay. Biphenyl tetrazole...

Microsomal Stability Studies

We next evaluated the stability of a subset of compounds in a murine hepatic microsome stability assay which utilizes liver microsomes. Liver microsomes possess many of the enzymes responsible for drug metabolism in vivo and are also a good predictor of drug clearance properties.51 On the basis of these data, it is clear that the fluoroacetamidine containing compounds are significantly more stable than their chloroacetamidine containing counterparts whose half-lives are similar to that obtained for Cl-amidine (Figure ​3D). The one exception is the ortho carboxyl derived tetrazole Cl-amidine (21) whose half-life mimics those obtained for the fluoro analogs, suggesting that modification of the N-terminus substantially improves the overall stability of the compounds.

Neutrophil Extracellular Trap (NET) Inhibition Studies

We and others have shown that PAD4 mediated histone hypercitrullination induces heterochromatin decondensation and chromatin unfolding to form NETs.52−56 Neutrophil extracellular trap (NET) formation causes direct organ damage and can trigger endothelial and epithelial cell death.37 Inhibition of PAD4 reduces NET formation in mouse neutrophils in vivo and human neutrophils in vitro.15 We have also shown that Cl-amidine treatment blocks NET formation and modulates the lupus phenotype in animal models.37 Furthermore, Cl-amidine mitigates atherosclerosis in the apolipoprotein-E (Apoe)–/– murine model40 and this activity correlates with decreased NET formation. Given these precedents, we next investigated whether our two best in vitro inhibitors, i.e., compounds 13 and 21, could block NET formation. To this end, mouse neutrophils were treated with PMA to stimulate NET formation in the absence and presence of increasing amounts of Cl-amidine, compound 13, and compound 21. Cl-amidine was used as the reference compound. NET formation was then quantified using the DNA/neutrophil elastase overlap assay. Though 21 is very potent in vitro, it inhibits NET formation only at very high concentrations. The negatively charged carboxyl group again likely limits its bioavailability. By contrast, the biphenyl derivative 13 is significantly more potent than Cl-amidine in the NET assays (Figure ​4), despite its being a significantly poorer PAD4 inhibitor in vitro. The enhanced cellular activity likely reflects the hydrophobic nature of the compound which enhances cellular uptake. We also evaluated the toxicity of 13 and 21, our two best inhibitors, against human neutrophils. The results of these studies indicate that 21 displays very limited cytotoxicity (EC50 = 985 ± 20). By contrast, 13 (EC50 = 31 ± 1.0) is considerably more toxic. Nevertheless, it is noteworthy that we see considerable inhibition of NET formation at lower doses (EC50 ≈ 20 μM) than those that cause cell killing.

Figure 4

Biphenyl tetrazole tert-butyl Cl-amidine (13) and o-carboxyl tetrazole tert-butyl Cl-amidine (21) inhibit NET formation. The DNA/neutrophil elastase overlap assay suggests that compound 13 significantly reduces NET formation compared to Cl-amidine. Compound...

Conclusions

In summary, we identified tetrazoles as a suitable C-terminal bioisosteric modification of Cl-amidine. A subset of the analogs show enhanced potencies and selectivities relative to Cl-amidine. Importantly, we confirmed that installation of an o-carboxylate enhances the in vitro potency of the compounds by up to 30-fold highlighting the importance of this pharmacophore. We also showed that incorporation of a tert-butyl group on the tetrazolium ring markedly increased the selectivity of the compounds for PAD2. Finally, our data indicate that enhanced cellular permeability can be achieved by increasing the hydrophobicity of the compounds. These design characteristics will be incorporated into future analogs as part of our continuing efforts to develop isozyme specific inhibitors for all of the PADs.

Materials and Methods

Chemicals

Dithiothreitol (DTT), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), ammonium iron(III) sulfate dodecahydrate, tris(2-carboxyethyl)phosphine (TCEP), and thiosemicarbazide were acquired from Sigma–Aldrich. Diacetylmonooxime (DAMO), N-α-benzoyl-l-arginine ethyl ester (BAEE), and N-α-benzoyl-l-arginine amide (BAA) were obtained from Acros. Detailed synthetic procedures are described in the Supporting Information. PAD1, -2, -3, and -4 were purified analogously to previously described methods.35,57

Inactivation Kinetics

The kinetic parameters of inactivation were determined by incubating PAD1, -2, or -4 (2.0 μM) or PAD3 (5.0 μM) in a prewarmed (10 min, 37 °C) inactivation mixture (50 mM HEPES, 10 mM CaCl2, and 2 mM DTT, pH 7.6, with a final volume of 60 μL) containing various concentrations of inhibitor. Aliquots were removed at various time points (0, 2, 6, 10, 15, 20, and 30 min or 0, 0.5, 1, 1.5, 2, 4, and 6 min) and added to a prewarmed (10 min, 37 °C) reaction mixture (50 mM HEPES, 50 mM NaCl, 10 mM CaCl2, 2 mM DTT, and 10 mM BAEE or 10 mM BAA in the case of PAD3; pH 7.6). After 15 min, reactions were quenched in liquid nitrogen and citrulline production quantified using the COLDER assay.58,59 Data were plotted as a function of time and fit to eq 1,

1

using GraFit, version 5.0.11, where v is velocity, vo is the initial velocity, kobs is the pseudo-first-order rate constant of inactivation (i.e., kobs), and t is time. The kobs values were then plotted against inhibitor concentration, and the data were fit to eq 2,

2

using GraFit, version 5.0.11. Since saturation was not observed in any of the plots, kinact/KI was calculated from the slope of the line. kinact corresponds to the maximal rate of inactivation, and KI is the concentration of inhibitor that gives half-maximal inactivation. For a subset of the less potent compounds, kinact/KI values were determined by dividing the kobs value at a single concentration by the concentration of the inhibitor tested.

Cell Viability

The human osteosarcoma (U2OS) cell line was plated (2.5 × 106 cells/well) in a 96-well plate. The next day the cells were treated with compounds (5 μL, 20 μM final), DMSO (5 μL), Triton X-100 (5 μL), or various concentrations of 13 or 14 and incubated for 72 h. Cell viability was measured using the XTT reagent kit (ATCC) by reading the absorption at 475 nm using a Spectramax plate reader. EC50 values for cell growth inhibition were determined by fitting an eight-point dose–response curve to eq 3,

3

using GraFit5.0.11, where range is the uninhibited value minus the background and s is the slope factor. For in vitro cytotoxicity assays with neutrophils, freshly isolated human neutrophils were resuspended in RPMI 1640 medium containing 10% fetal bovine serum and then seeded into poly-l-lysine coated 96-well plates at 40 000 cells/well. After the cells were allowed to adhere for 1 h, neutrophils were incubated for 4 h with 13 or 21 at concentrations ranging from 1 to 500 μM. Cell viability after drug exposure was measured using the XTT cell viability kit as described above.

Neutrophil Isolation

C57BL/6 mice were purchased from The Jackson Laboratory. Bone marrow neutrophils were isolated essentially as described previously.60 Briefly, bone marrow was flushed from femurs and tibias with Hank’s balanced salt solution supplemented with 15 mM EDTA. Cells were then spun on a discontinuous Percoll gradient (52%, 69%, 78%) at 1500g for 30 min. Cells from the 69–78% interface were collected, and red blood cells were lysed. Cells were >95% Ly-6G-positive and had typical segmented nuclei by microscopy.

NET Quantification and Microscopy

A protocol similar to what we have described previously was followed.61 Briefly, 1.5 × 105 neutrophils were seeded onto glass coverslips coated with 0.001% poly-l-lysine (Sigma). PAD inhibitors were used at the indicated concentrations, including a 30 min pretreatment in Locke’s solution (150 mM NaCl, 5 mM KCl, 2 mM CaCl2, 0.1% glucose, and 10 mM HEPES buffer, pH 7.3). Stimulation was with 100 nM PMA (Sigma) for 3–4 h in RPMI-1640 supplemented with l-glutamine, 2% BSA, and 10 mM HEPES buffer. Cells were then fixed with 4% paraformaldehyde (PFA) for 20 min, followed by blocking with 10% fetal bovine serum; cells were not specifically permeabilized. DNA was stained with Hoechst 33342 (Invitrogen), while protein staining was with a rabbit polyclonal antibody to myeloperoxidase (A0398, Dako) followed by FITC-conjugated anti-rabbit IgG (4052-02, SouthernBiotech). After staining, coverslips were mounted in Prolong Gold antifade reagent (Invitrogen). Images were collected with an Olympus microscope (IX70) and a CoolSNAP HQ2 monochrome camera (Photometrics) with Metamorph Premier software (Molecular Devices), typically at 400× magnification. Statistical background correction and image overlays were with Metamorph, and the recorded images were loaded onto Adobe Photoshop for further analysis, at which time NETs were manually quantified by two blinded observers. Decondensed nuclei that also stained positively for myeloperoxidase were considered NETs and digitally recorded to prevent multiple counts. The percentage of NETs was calculated as the average of at least five fields and normalized to the total number of cells.

Acknowledgments

The authors are most grateful to Rose L. Szabady and Beth McCormick for providing the human neutrophils for the cytotoxicity studies. Financial support for this work was provided by NIH Grants GM079357 (P.R.T.) and GM110394 (P.R.T. and S.A.C.) and in part by the intramural research program at NIAMS.

Glossary

Abbreviations Used

TFAtrifluoroacetic acid
MeOHmethanol
ACNacetonitrile
DMFdimethylformamide
NMMN-methylmorpholine
HBTUO-benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate
DTTdithiothreitol
BAEEbenzoyl-l-arginine ethyl ester
BAAbenzoyl-l-arginine amide
PADprotein arginine deiminase
COLDERcolor development reagent
Bzbenzoyl
Ornornithine
Ttetrazole
TTtetrazole tert-butyl
Bbiphenyl

Funding Statement

National Institutes of Health, United States

Supporting Information Available

Synthetic procedures, experimental details, and Table S1. This material is available free of charge via the Internet at http://pubs.acs.org.

Notes

The authors declare the following competing financial interest(s): P.R.T is a cofounder and consultant to Padlock Therapeutics.

References

  • Stone E. M.; Schaller T. H.; Bianchi H.; Person M. D.; Fast W. Inactivation of two diverse enzymes in the amidinotransferase superfamily by 2-chloroacetamidine: dimethylargininase and peptidylarginine deiminase. Biochemistry 2005, 44, 13744–13752. [PubMed]
  • Jones J. E.; Causey C. P.; Knuckley B.; Slack-Noyes J. L.; Thompson P. R. Protein arginine deiminase 4 (PAD4): current understanding and future therapeutic potential. Curr. Opin Drug Discovery Dev. 2009, 12, 616–627. [PMC free article][PubMed]
  • Vossenaar E. R.; Zendman A. J.; van Venrooij W. J.; Pruijn G. J. PAD, a growing family of citrullinating enzymes: genes, features and involvement in disease. BioEssays 2003, 25, 1106–1118. [PubMed]
  • Slade D. J.; Subramanian V.; Thompson P. R. Citrulination unravels stem cells. Nat. Chem. Biol. 2014, 10, 327–328. [PubMed]
  • Slade D. J.; Subramanian V.; Fuhrmann J.; Thompson P. R. Chemical and biological methods to detect post-translational modifications of arginine. Biopolymers 2014, 101, 133–143. [PubMed]
  • Suzuki A.; Yamada R.; Yamamoto K. Citrullination by peptidylarginine deiminase in rheumatoid arthritis. Ann. N.Y. Acad. Sci. 2007, 1108, 323–339. [PubMed]
  • Vossenaar E. R.; Nijenhuis S.; Helsen M. M.; van der Heijden A.; Senshu T.; van den Berg W. B.; van Venrooij W. J.; Joosten L. A. Citrullination of synovial proteins in murine models of rheumatoid arthritis. Arthritis Rheum. 2003, 48, 2489–2500. [PubMed]
  • Moscarello M. A.; Mastronardi F. G.; Wood D. D. The role of citrullinated proteins suggests a novel mechanism in the pathogenesis of multiple sclerosis. Neurochem. Res. 2007, 32, 251–256. [PubMed]
  • Ishigami A.; Ohsawa T.; Hiratsuka M.; Taguchi H.; Kobayashi S.; Saito Y.; Murayama S.; Asaga H.; Toda T.; Kimura N.; Maruyama N. Abnormal accumulation of citrullinated proteins catalyzed by peptidylarginine deiminase in hippocampal extracts from patients with Alzheimer’s disease. J. Neurosci. Res. 2005, 80, 120–128. [PubMed]
  • Jang B.; Jin J. K.; Jeon Y. C.; Cho H. J.; Ishigami A.; Choi K. C.; Carp R. I.; Maruyama N.; Kim Y. S.; Choi E. K. Involvement of peptidylarginine deiminase-mediated post-translational citrullination in pathogenesis of sporadic Creutzfeldt–Jakob disease. Acta Neuropathol. 2010, 119, 199–210. [PubMed]
  • Jang B.; Kim E.; Choi J. K.; Jin J. K.; Kim J. I.; Ishigami A.; Maruyama N.; Carp R. I.; Kim Y. S.; Choi E. K. Accumulation of citrullinated proteins by up-regulated peptidylarginine deiminase 2 in brains of scrapie-infected mice: a possible role in pathogenesis. Am. J. Pathol. 2008, 173, 1129–1142. [PubMed]
  • Wang Y.; Li P.; Wang S.; Hu J.; Chen X. A.; Wu J.; Fisher M.; Oshaben K.; Zhao N.; Gu Y.; Wang D.; Chen G.; Wang Y. Anticancer peptidylarginine deiminase (PAD) inhibitors regulate the autophagy flux and the mammalian target of rapamycin complex 1 activity. J. Biol. Chem. 2012, 287, 25941–25953. [PubMed]
  • Harauz G.; Musse A. A. A tale of two citrullines—structural and functional aspects of myelin basic protein deimination in health and disease. Neurochem. Res. 2007, 32, 137–158. [PubMed]
  • Kidd B. A.; Ho P. P.; Sharpe O.; Zhao X.; Tomooka B. H.; Kanter J. L.; Steinman L.; Robinson W. H. Epitope spreading to citrullinated antigens in mouse models of autoimmune arthritis and demyelination. Arthritis Res. Ther. 2008, 10, R119. [PubMed]
  • Rohrbach A. S.; Slade D. J.; Thompson P. R.; Mowen K. A. Activation of PAD4 in NET formation. Front. Immunol. 2012, 3, 360. [PubMed]
  • Li P.; Li M.; Lindberg M. R.; Kennett M. J.; Xiong N.; Wang Y. PAD4 is essential for antibacterial innate immunity mediated by neutrophil extracellular traps. J. Exp. Med. 2010, 207, 1853–1862. [PubMed]
  • Luo Y.; Knuckley B.; Lee Y. H.; Stallcup M. R.; Thompson P. R. A fluoroacetamidine-based inactivator of protein arginine deiminase 4: design, synthesis, and in vitro and in vivo evaluation. J. Am. Chem. Soc. 2006, 128, 1092–1093. [PubMed]
  • Luo Y.; Arita K.; Bhatia M.; Knuckley B.; Lee Y. H.; Stallcup M. R.; Sato M.; Thompson P. R. Inhibitors and inactivators of protein arginine deiminase 4: functional and structural characterization. Biochemistry 2006, 45, 11727–11736. [PubMed]
  • Knuckley B.; Luo Y.; Thompson P. R. Profiling protein arginine deiminase 4 (PAD4): a novel screen to identify PAD4 inhibitors. Bioorg. Med. Chem. 2008, 16, 739–745. [PubMed]
  • Golub L. M.; McNamara T. F.; D’Angelo G.; Greenwald R. A.; Ramamurthy N. S. A non-antibacterial chemically-modified tetracycline inhibits mammalian collagenase activity. J. Dent. Res. 1987, 66, 1310–1314. [PubMed]
  • Greenwald R. A.; Golub L. M.; Lavietes B.; Ramamurthy N. S.; Gruber B.; Laskin R. S.; McNamara T. F. Tetracyclines inhibit human synovial collagenase in vivo and in vitro. J. Rheumatol. 1987, 14, 28–32. [PubMed]
  • Golub L. M.; Lee H. M.; Lehrer G.; Nemiroff A.; McNamara T. F.; Kaplan R.; Ramamurthy N. S. Minocycline reduces gingival collagenolytic activity during diabetes. Preliminary observations and a proposed new mechanism of action. J. Periodontal Res. 1983, 18, 516–526. [PubMed]
  • Alano C. C.; Kauppinen T. M.; Valls A. V.; Swanson R. A. Minocycline inhibits poly(ADP-ribose) polymerase-1 at nanomolar concentrations. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 9685–9690. [PubMed]
  • Imamura T.; Matsushita K.; Travis J.; Potempa J. Inhibition of trypsin-like cysteine proteinases (gingipains) from Porphyromonas gingivalis by tetracycline and its analogues. Antimicrob. Agents Chemother. 2001, 45, 2871–2876. [PubMed]
  • Pruzanski W.; Vadas P. Should tetracyclines be used in arthritis?. J. Rheumatol. 1992, 19, 1495–1497. [PubMed]
  • Trentham D. E.; Dynesius-Trentham R. A. Antibiotic therapy for rheumatoid arthritis. Scientific and anecdotal appraisals. Rheum. Dis. Clin. North Am. 1995, 21, 817–834. [PubMed]
  • Forsgren A.; Schmeling D.; Quie P. G. Effect of tetracycline on the phagocytic function of human leukocytes. J. Infect. Dis. 1974, 130, 412–415. [PubMed]
  • Li P.; Yao H.; Zhang Z.; Li M.; Luo Y.; Thompson P. R.; Gilmour D. S.; Wang Y. Regulation of p53 target gene expression by peptidylarginine deiminase 4. Mol. Cell. Biol. 2008, 28, 4745–4758. [PubMed]
  • Zhang X.; Bolt M.; Guertin M. J.; Chen W.; Zhang S.; Cherrington B. D.; Slade D. J.; Dreyton C. J.; Subramanian V.; Bicker K. L.; Thompson P. R.; Mancini M. A.; Lis J. T.; Coonrod S. A. Peptidylarginine deiminase 2-catalyzed histone H3 arginine 26 citrullination facilitates estrogen receptor alpha target gene activation. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 13331–13336. [PubMed]
  • Zhang X.; Gamble M. J.; Stadler S.; Cherrington B. D.; Causey C. P.; Thompson P. R.; Roberson M. S.; Kraus W. L.; Coonrod S. A. Genome-wide analysis reveals PADI4 cooperates with Elk-1 to activate c-Fos expression in breast cancer cells. PLoS Genet. 2011, 7, e1002112. [PubMed]
  • Yao H.; Li P.; Venters B. J.; Zheng S.; Thompson P. R.; Pugh B. F.; Wang Y. Histone Arg modifications and p53 regulate the expression of OKL38, a mediator of apoptosis. J. Biol. Chem. 2008, 283, 20060–20068. [PubMed]
  • Wang Y.; Li M.; Stadler S.; Correll S.; Li P.; Wang D.; Hayama R.; Leonelli L.; Han H.; Grigoryev S. A.; Allis C. D.; Coonrod S. A. Histone hypercitrullination mediates chromatin decondensation and neutrophil extracellular trap formation. J. Cell Biol. 2009, 184, 205–213. [PubMed]
  • Chumanevich A. A.; Causey C. P.; Knuckley B. A.; Jones J. E.; Poudyal D.; Chumanevich A. P.; Davis T.; Matesic L. E.; Thompson P. R.; Hofseth L. J. Suppression of colitis in mice by Cl-amidine: a novel peptidylarginine deiminase inhibitor. Am. J. Physiol.: Gastrointest. Liver Physiol. 2011, 300, G929–938. [PubMed]
  • Lange S.; Gogel S.; Leung K. Y.; Vernay B.; Nicholas A. P.; Causey C. P.; Thompson P. R.; Greene N. D.; Ferretti P. Protein deiminases: new players in the developmentally regulated loss of neural regenerative ability. Dev. Biol. 2011, 355, 205–214. [PubMed]
  • Causey C. P.; Jones J. E. Jr.; Slack J. L.; Kamei D.; Jones L. E.; Subramanian V.; Knuckley B.; Ebrahimi P.; Chumanevich A. A.; Luo Y.; Hashimoto H.; Sato M.; Hofseth L. J.; Thompson P. R. The development of N-α-(2-carboxyl)benzoyl-N5-(2-fluoro-1-iminoethyl)-l-ornithine amide (o-F-amidine) and N-α-(2-carboxyl)benzoyl-N5-(2-chloro-1-iminoethyl)-l-ornithine amide (o-Cl-amidine) as second generation protein arginine deiminase (PAD) inhibitors. J. Med. Chem. 2011, 54, 6919–6935. [PubMed]
  • Knight J. S.; Kaplan M. J. Lupus neutrophils: “NET” gain in understanding lupus pathogenesis. Curr. Opin. Rheumatol. 2012, 24, 441–450. [PubMed]
  • Knight J. S.; Zhao W.; Luo W.; Subramanian V.; O’Dell A. A.; Yalavarthi S.; Hodgin J. B.; Eitzman D. T.; Thompson P. R.; Kaplan M. J. Peptidylarginine deiminase inhibition is immunomodulatory and vasculoprotective in murine lupus. J. Clin. Invest. 2013, 123, 2981–2993. [PubMed]
  • Khandpur R.; Carmona-Rivera C.; Vivekanandan-Giri A.; Gizinski A.; Yalavarthi S.; Knight J. S.; Friday S.; Li S.; Patel R. M.; Subramanian V.; Thompson P.; Chen P.; Fox D. A.; Pennathur S.; Kaplan M. J. NETs are a source of citrullinated autoantigens and stimulate inflammatory responses in rheumatoid arthritis. Sci. Transl. Med. 2013, 5, 178ra140. [PMC free article][PubMed]
  • Smith C. K.; Vivekanandan-Giri A.; Tang C.; Knight J. S.; Mathew A.; Padilla R. L.; Gillespie B. W.; Carmona-Rivera C.; Liu X.; Subramanian V.; Hasni S.; Thompson P. R.; Heinecke J. W.; Saran R.; Pennathur S.; Kaplan M. J. Neutrophil extracellular trap-derived enzymes oxidize high-density lipoprotein: An additional proatherogenic mechanism in systemic lupus erythematosus. Arthritis Rheum. 2014, 66, 2532–2544. [PMC free article][PubMed]
  • Knight J. S.; Luo W.; O’Dell A. A.; Yalavarthi S.; Zhao W.; Subramanian V.; Guo C.; Grenn R. C.; Thompson P. R.; Eitzman D. T.; Kaplan M. J. Peptidylarginine deiminase inhibition reduces vascular damage and modulates innate immune responses in murine models of atherosclerosis. Circ. Res. 2014, 114, 947–956. [PubMed]
  • McElwee J. L.; Mohanan S.; Griffith O. L.; Breuer H. C.; Anguish L. J.; Cherrington B. D.; Palmer A. M.; Howe L. R.; Subramanian V.; Causey C. P.; Thompson P. R.; Gray J. W.; Coonrod S. A. Identification of PADI2 as a potential breast cancer biomarker and therapeutic target. BMC Cancer 2012, 12, 500. [PubMed]
  • Jones J. E.; Slack J. L.; Fang P.; Zhang X.; Subramanian V.; Causey C. P.; Coonrod S. A.; Guo M.; Thompson P. R. Synthesis and screening of a haloacetamidine containing library to identify PAD4 selective inhibitors. ACS Chem. Biol. 2012, 7, 160–165. [PubMed]
  • Bicker K. L.; Anguish L.; Chumanevich A. A.; Cameron M. D.; Cui X.; Witalison E.; Subramanian V.; Zhang X.; Chumanevich A. P.; Hofseth L. J.; Coonrod S. A.; Thompson P. R. d-Amino acid based protein arginine deiminase inhibitors: synthesis, pharmacokinetics, and in cellulo efficacy. ACS Med. Chem. Lett. 2012, 3, 1081–1085. [PubMed]
  • Herr R. J. 5-Substituted-1H-tetrazoles as carboxylic acid isosteres: medicinal chemistry and synthetic methods. Bioorg. Med. Chem. 2002, 10, 3379–3393. [PubMed]
  • Nachman R. J.; Zabrocki J.; Olczak J.; Williams H. J.; Moyna G.; Ian Scott A.; Coast G. M. Cis-peptide bond mimetic tetrazole analogs of the insect kinins identify the active conformation. Peptides 2002, 23, 709–716. [PubMed]
  • Zabrocki J.; Marshall G. R. The 1,5-disubstituted tetrazole ring as a cis-amide bond surrogate. Methods Mol. Med. 1999, 23, 417–436. [PubMed]
  • Ostrovskii V. A.; Koren A. O. Alkylation and related electrophilic reactions at endocyclic nitrogen atoms in the chemistry of tetrazoles. Heterocycles 2000, 53, 1421–1448.
  • Causey C. P.; Thompson P. R. An improved synthesis of haloaceteamidine-based inactivators of protein arginine deiminase 4 (PAD4). Tetrahedron Lett. 2008, 49, 4383–4385. [PubMed]
  • Luo Y.; Knuckley B.; Bhatia M.; Thompson P. R. Activity based protein profiling reagents for protein arginine deiminase 4 (PAD4): synthesis and in vitro evaluation of a fluorescently-labeled probe. J. Am. Chem. Soc. 2006, 128, 14468–14469. [PubMed]
  • Slack J. L.; Causey C. P.; Luo Y.; Thompson P. R. The development and use of clickable activity based protein profiling agents for protein arginine deiminase 4. ACS Chem. Biol. 2011, 6, 466–476. [PubMed]
  • Baranczewski P.; Stanczak A.; Sundberg K.; Svensson R.; Wallin A.; Jansson J.; Garberg P.; Postlind H. Introduction to in vitro estimation of metabolic stability and drug interactions of new chemical entities in drug discovery and development. Pharmacol. Rep. 2006, 58, 453–472. [PubMed]
  • Leshner M.; Wang S.; Lewis C.; Zheng H.; Chen X. A.; Santy L.; Wang Y. PAD4 mediated histone hypercitrullination induces heterochromatin decondensation and chromatin unfolding to form neutrophil extracellular trap-like structures. Front. Immunol. 2012, 3, 307. [PubMed]
  • Li P. X.; Li M.; Lindberg M. R.; Kennett M. J.; Xiong N.; Wang Y. M. PAD4 is essential for antibacterial innate immunity mediated by neutrophil extracellular traps. J. Exp. Med. 2010, 207, 1853–1862. [PubMed]
  • Martinod K.; Demers M.; Fuchs T. A.; Wong S. L.; Brill A.; Gallant M.; Hu J.; Wang Y. M.; Wagner D. D. Neutrophil histone modification by peptidylarginine deiminase 4 is critical for deep vein thrombosis in mice. Proc. Natl. Acad. Sci. U.S.A. 2013, 110, 8674–8679. [PubMed]
  • Brinkmann V.; Reichard U.; Goosmann C.; Fauler B.; Uhlemann Y.; Weiss D. S.; Weinrauch Y.; Zychlinsky A. Neutrophil extracellular traps kill bacteria. Science 2004, 303, 1532–1535. [PubMed]
  • Brinkmann V.; Zychlinsky A. Neutrophil extracellular traps: Is immunity the second function of chromatin?. J. Cell Biol. 2012, 198, 773–783. [PubMed]
  • Knuckley B.; Causey C. P.; Jones J. E.; Bhatia M.; Dreyton C. J.; Osborne T. C.; Takahara H.; Thompson P. R. Substrate specificity and kinetic studies of PADs 1, 3, and 4 identify potent and selective inhibitors of protein arginine deiminase 3. Biochemistry 2010, 49, 4852–4863. [PubMed]
  • Knipp M.; Vasak M. A colorimetric 96-well microtiter plate assay for the determination of enzymatically formed citrulline. Anal. Biochem. 2000, 286, 257–264. [PubMed]
  • Kearney P. L.; Bhatia M.; Jones N. G.; Luo Y.; Glascock M. C.; Catchings K. L.; Yamada M.; Thompson P. R. Kinetic characterization of protein arginine deiminase 4: a transcriptional corepressor implicated in the onset and progression of rheumatoid arthritis. Biochemistry 2005, 44, 10570–10582. [PubMed]
  • Boxio R.; Bossenmeyer-Pourie C.; Steinckwich N.; Dournon C.; Nusse O. Mouse bone marrow contains large numbers of functionally competent neutrophils. J. Leukocyte Biol. 2004, 75, 604–611. [PubMed]
  • Villanueva E.; Yalavarthi S.; Berthier C. C.; Hodgin J. B.; Khandpur R.; Lin A. M.; Rubin C. J.; Zhao W. P.; Olsen S. H.; Klinker M.; Shealy D.; Denny M. F.; Plumas J.; Chaperot L.; Kretzler M.; Bruce A. T.; Kaplan M. J. Netting neutrophils induce endothelial damage, infiltrate tissues, and expose immunostimulatory molecules in systemic lupus erythematosus. J. Immunol. 2011, 187, 538–552. [PubMed]

INTRODUCTION

Peptidyl arginine deiminases (PADs) are a family of five enzymes that mediate hydrolytic deimination (citrullination) of arginine residues. PAD4 is a nuclear member of the family and has been reported to be highly expressed in granulocytes, various cancer types, and pluripotent stem cells (1, 2). Hypercitrullination of histones is associated with the release of neutrophil extracellular traps (NETs) as part of the innate immune response and opening of chromatin in pluripotent stem cells. More specific transcriptional regulatory roles have also been ascribed to PAD4, in relation to both citrullination of specific histone residues and other cellular substrates (3, 4). The growing interest in PAD enzymes as pharmacological targets reflects the increasingly prominent role that they have been reported to play in the context of inflammatory disorders (particularly rheumatoid arthritis) and also cancer.

The E2F family of transcription factors, although historically connected with cell cycle control, is involved with regulating diverse cellular outcomes, including apoptosis, differentiation, metabolism, and inflammation (5, 6). However, the mechanisms that underpin and guide the diverse biological roles of E2F-1 have yet to be identified, although insights from arginine methylation suggest that posttranslational modifications are deterministic. Thus, it is known that methylation in an arginine-rich region influences cell viability or cell death, reflective of the type of methylation event that occurs; PRMT1 (protein arginine methyltransferase 1)–mediated methylation augments apoptosis, contrasting with PRMT5-mediated methylation, which renders E2F-1 with growth-promoting activity (7).

Because citrullination occurs on arginine residues (8), we reasoned that PAD4 might influence the biological output of E2F-1 if functionally important arginine residues were to be modified. Here, we show that E2F-1 is citrullinated by PAD4 in inflammatory cells, where it augments the chromatin association of E2F-1 to cytokine genes. Significantly, the BET (bromodomain and extra-terminal domain) bromodomain family protein BRD4 (bromodomain-containing protein 4) binds to acetylated lysine residues in E2F-1, and PAD4 regulates the association between E2F-1 and BRD4. Our results show the crucial regulatory interplay between citrullination and acetylation during the inflammatory response and its role in dictating the biological outcome of E2F activity.

RESULTS

Successful PAD4-mediated citrullination of recombinant and endogenous E2F-1 was demonstrated in vitro, both biochemically (Fig. 1A, lane 7) and in U2OS cells (Fig. 1B). The comparison of N-terminal (1 to 194) and C-terminal (194 to 437) derivatives (fig. S1A) indicated that the N-terminal region of E2F-1 is more susceptible to citrullination than the C-terminal region (Fig. 1C). Arginine (R) residues 109 and 127 were identified by mass spectrometry as the predominant sites of citrullination (fig. S1, B and C), although site-directed mutagenesis implied that R111/R113 could also be involved (fig. S1D). Accordingly, E2F-1 and PAD4 were shown to interact in cells (Fig. 1D), principally through the N-terminal region of E2F-1 (fig. S2A). In a gene reporter assay, using the promoter region taken from established E2F target genes (including TP73 and CDC6), exogenous PAD4 increased E2F-1 activity (fig. S2B), whereas PAD4 inhibition reduced E2F-1 activity (fig. S2D) using the PAD4-specific inhibitor TDFA (Thr-Asp-F-amidine) (9) (but not the inactive analog TDHA). Furthermore, the noncitrullinated R4K E2F-1 mutant derivative (R109K/R111K/R113K/R127K; see fig. S1A) was not affected by PAD4 relative to wild-type E2F-1 (Fig. 1E). Quantitative measurements of E2F-1 binding to its target gene promoters by chromatin immunoprecipitation (ChIP) revealed that PAD4 enhanced the chromatin association of E2F-1 but not the R4K mutant (Fig. 1G and fig. S2F). PAD4 was itself recruited to E2F-1 target genes, in an E2F-1–dependent manner, because E2F-1 depletion using small interfering RNA (siRNA) diminished PAD4 binding (Fig. 1I). We therefore conclude that PAD4 can enhance the activity and DNA binding properties of E2F-1.

We surmised that PAD4-dependent citrullination of E2F-1 might be involved in regulating a subgroup of E2F target genes, to which end we performed transcript profiling in U2OS cells depleted of E2F-1 and PAD4 (Fig. 2A). Pathway enrichment analysis using Gene Set Enrichment Analysis (GSEA) (10) revealed significant down-regulation of immune response upon both E2F-1 and PAD4 depletion (Fig. 2A). Furthermore, many of the co-regulated genes were involved in the inflammatory response when analyzed by PANTHER (Protein Analysis Through Evolutionary Relationships) (11) (fig. S3, A and B), and the E2F DNA binding motif was enriched in the promoter region of many of these genes as determined by CENTDIST (12) (fig. S3, C and D). Given previous reports for the involvement of E2F-1 (6) and PAD4 (3) in inflammation, we reasoned that PAD4-mediated citrullination of E2F-1 may regulate inflammatory gene expression.

HL60 cells are myeloid leukemic cells that can differentiate to granulocytes with dimethyl sulfoxide (DMSO) or all-trans-retinoic acid (ATRA) (13). Consistent with previous reports, we observed a robust induction of PAD4 expression in HL60 cells differentiated into granulocytes (14) (Fig. 2B and fig. S4A), with both PAD4 and E2F-1 demonstrating nuclear localization (fig. S4B). In granulocyte-differentiated HL60 cells, we observed an interaction between endogenous E2F-1 and PAD4 (Fig. 2C and fig. S4C), and E2F-1 exhibited increased levels of citrullination (Fig. 2D). We investigated the recruitment of E2F-1 to the candidate inflammatory genes TNFα (tumor necrosis factor–α), CCL3 [chemokine (C-C motif) ligand-3], and IL-1β (interleukin-1β) because they have previously been shown to be up-regulated in differentiated HL60 cells (15) and are known E2F-1 target genes (6). We observed strong chromatin binding of E2F-1 to the promoters of these cytokine genes in differentiated cells (Fig. 2E, lane 3 versus lane 7), but a decrease in promoter occupancy of pRB (retinoblastoma protein) (Fig. 2E, lane 4 versus lane 8), which negatively regulates E2F-1–dependent transcription (16). Increasing levels of E2F-1 on the TNFα promoter were also detected in HL60 cells cotreated with DMSO and TNFα (fig. S4D), which coincided with increased PAD4 activity, because citrullination of histone 3 (H3) (8) was enhanced under these conditions (fig. S4E). Crucially, treatment of differentiated HL60 cells with either the pan-PAD inhibitor BB-Cl-amidine (17) (Fig. 2F) or the PAD4-specific inhibitor GSK484 (18) (Fig. 2H) prevented E2F-1 recruitment to several cytokine gene promoters, thus implying that PAD4 is responsible for targeting E2F-1 to inflammatory genes.

We then investigated the mechanism through which PAD4 augments E2F-1 activity. Because certain bromodomain reader proteins participate in inflammatory gene expression (19), we reasoned that recruitment of bromodomains may influence E2F-1 activity during the inflammatory response. We screened a large collection of bromodomains for binding to E2F-1 peptides and identified the BET family, including the two bromodomains of BRD4 [bromodomain 1 (BD1) and BD2], as putative readers of acetylated E2F-1 (Fig. 3A). We focused on BRD4 because it is involved in modulating immune response gene expression (20), it is known to bind dual/polyacetylation residues (21) (rendering interplay with proximal citrulline marks possible), and its recognition of E2F-1 had not been previously explored. The interaction between E2F-1 and both bromodomains of BRD4 was confirmed in cells (Fig. 3B) and was dependent on the acetylated lysine residues in E2F-1, because E2F-1 K3R, a mutant derivative lacking the sites of lysine acetylation (22) (fig. S1A), could not interact with BRD4 (fig. S4F). We found that BRD4 can interact with E2F-1 on cytokine gene promoters (Fig. 3D) in differentiated HL60 cells and endogenous E2F-1 immunoprecipitated BRD4 (Fig. 3C) when using double ChIP. Moreover, the BET inhibitor JQ1 (23) was seen to disrupt the E2F-1/BRD4 complex on promoters (Fig. 3, E and F) and in cells (fig. S4G), suggesting that BRD4 interacts with E2F-1 via its bromodomains and drives the expression of inflammatory genes.

Having established that PAD4 is important for directing E2F-1 inflammatory gene expression and, further, that BRD4 reads E2F-1 acetylation on inflammatory gene promoters, we surmised that interplay might occur between citrullination and acetylation marks in regulating the inflammatory role of E2F-1. This idea was also suggested from the SPOT array, where an enhanced interaction between E2F-1 peptides and BET bromodomains was apparent when a citrulline flanked an acetyl modification (fig. S4H). To test this idea, we treated differentiated HL60 cells with BB-Cl-amidine and monitored the interaction between E2F-1 and BRD4. Significantly, BB-Cl-amidine treatment reduced the level of the chromatin-bound E2F-1/BRD4 complex as measured by double ChIP (Fig. 3G and fig. S4I), and in U2OS cells treated with BB-Cl-amidine, a reduced interaction between E2F-1 and BD1 bromodomain of BRD4 was evident (Fig. 3J). Thereafter, we measured the expression level of cytokine genes regulated by E2F-1 in cells treated with BB-Cl-amidine and JQ1. Whereas BB-Cl-amidine and JQ1 reduced cytokine expression in cells treated with each compound alone, the combined treatment was able to reduce the expression even further (Fig. 4A).

These results implied a functional interplay between citrullination and lysine acetylation in regulating E2F-1–dependent inflammatory gene expression. We inquired whether similar effects could be recapitulated in vivo in animal models of inflammation and chose to study collagen-induced arthritis (CIA) (24). We treated arthritic mice with JQ1, BB-Cl-amidine, or both inhibitors together and monitored any effect on paw swelling. We used a dose of each compound (JQ1, 5 mg/kg; BB-Cl-amidine, 1 mg/kg) that, when administered alone, had a modest effect on disease progression (Fig. 4C). As a control, we administered a high dose of JQ1 (10 mg/kg), which, as expected (25), was seen to effectively control paw swelling (Fig. 4C). Crucially, when the two subtherapeutic doses of BB-Cl-amidine and JQ1 (5 or 1 mg/kg) were administered in combination, a marked reduction in clinical symptoms was observed (Fig. 4D).

ChIP analysis on spleen tissue (used as a surrogate tissue source) illustrated that E2F-1 binding to TNFα promoter is diminished in JQ1/BB-Cl-amidine–cotreated mice relative to untreated CIA mice (Fig. 4E), with this coinciding with reduced TNFα transcript levels in the spleen (Fig. 4F). Furthermore, the level of proinflammatory cytokines TNFα and IL-6 measured in the inguinal lymph nodes was reduced with the combination treatment to a level comparable to the treatment with high dose of JQ1 (10 mg/kg) (Fig. 4G). This was consistent with immunohistochemistry pathology examination on paw tissue, which found that the high levels of E2F-1 in the arthritic joints were very much reduced levels in JQ1- or BB-Cl-amidine–treated mice (Fig. 4H). We therefore conclude that the JQ1/BB-Cl-amidine combined treatment reduces the chromatin association of E2F-1 in clinical disease, which reflects reduced cytokine expression and alleviation of clinical symptoms in the CIA mice.

MATERIALS AND METHODS

Cell culture and compound treatments

U2OS and HL60 cell lines were obtained from the American Type Culture Collection. They were maintained in Dulbecco’s modified Eagle’s medium (DMEM) and RPMI-1640 medium (Sigma), respectively, supplemented with 10% (v/v) fetal calf serum (FCS) (Biosera) and 1% (v/v) penicillin-streptomycin (pen-strep) (Gibco). Stable Tet-On cell lines expressing inducible Flag-PAD4 were maintained in DMEM supplemented with 5% (v/v) Tet-negative FCS, G418 (100 μg/ml) (Clontech), 0.3% hygromycin (Clontech), and 1% (v/v) pen-strep. Doxycycline (1 μg/ml) was used to induce PAD4 expression in Flag-PAD4.pTRE cells. HL60 cells were differentiated into granulocyte-like cells upon treatment with 1% DMSO (tissue culture grade, Sigma) or 1 μM ATRA for 48 to 72 hours. They were differentiated into macrophage/monocyte-like cells upon treatment with 10 nM TPA for 48 to 72 hours. The expression of CD11B cell surface marker was used to confirm differentiation. Given the report that a higher percentage of HL60 cells are responsive to differentiation by DMSO than ATRA (13), DMSO treatment was used for this study. Where indicated, cells were treated with LPS (100 ng/ml) or TNFα (10 ng/ml) for 3 hours. TDFA and GSK484 are selective PAD4 inhibitors, BB-Cl-amidine is a pan-PAD inhibitor (particularly of isoforms 2 and 4), and JQ1 is a selective BET inhibitor.

Antibodies

PAD4 (ab128086 and ab50247, Abcam), HA (MMS-101R, Covance), Flag (F3165, Sigma), AMC antibody kit (17-347, Millipore), E2F-1 (KH95 and C20, Santa Cruz Biotechnology), BRD4 (ab128874, Abcam), β-actin (A2228, Sigma), pRB (IF8, Santa Cruz Biotechnology), CD11B (ab75476, Abcam), mouse and rabbit secondary antibodies (GE Healthcare), and HA or Flag antibody-coupled agarose beads (Sigma) were used.

RNA isolation and PCR

RNA was extracted from cells using TRIzol reagent (Life Technologies) in accordance with the manufacturer’s guidelines. Reverse transcription was preformed using SuperScript III Reverse Transcriptase (Life Technologies), and the complementary DNA (cDNA) was used as template in PCR [using Paq5000 DNA Polymerase (Agilent Technologies)] or qRT-PCR [using Brilliant III SYBR Master Mix (Agilent Technologies)]. For qRT-PCR analysis, transcript levels were normalized to housekeeping gene GAPDH. The primer sequences used are as follows: E2F-1, AAGCCCTGTCAGAAATCCAG (forward) and AGGCCCTCGACTACCACTT (reverse); GAPDH, ACCTTGCCCACAGCCTTGGC (forward) and ATCATCCCTGCCTCTACTGG (reverse); TNFα (human), CGCCGTCTCCTACCAGACCAAGGTCAAC (forward) and ATGATCCCAAAGTAGACCTGCCCAGACTCG (reverse); TNFα (mouse), TACTGAACTTCGGGGTGATTGGTCC (forward) and CAGCCTTGTCCCTTGAAGAGAACC (reverse); IL-1β, AACCTATCTTCTTCGACACATGGGATAACG (forward) and CAAGGCCACAGGTATTTTGTCATTACTTTC (reverse); CCL3, CCTTGCTGTCCTCCTCTGCACCATGGCTCT (forward) and GGTCGCTGACATATTTCTGGACCCACTCCT (reverse); and PAD4, CATGTTCCACCACTTGAAGG (forward) and TCACCTACCACATCAGGCAT (reverse).

DNA plasmid transfection

Plasmids of interest were transfected into cells using GeneJuice Transfection Reagent (Invitrogen) in accordance with the manufacturer’s guidelines.

Small interfering RNA

siRNA of interest was transfected into cells using Oligofectamine Transfection Reagent (Life Technologies) in accordance with the manufacturer’s guidelines. E2F-1 siRNA sequence: AACUCCUCGCAGAUCGUCAUC; PAD4 siRNA sequence: GGUCCUGCUACAAACUGUUTT; nontargeting sequence: Dharmacon NT3 control siRNA

Immunoblotting

Cells were lysed in modified radioimmunoprecipitation assay lysis buffer {150 mM NaCl, 50 mM tris-HCl (pH 7.5), 1% NP-40, 0.1% deoxycholic acid, 1 mM EDTA, 1 mM NaF, 1 mM Na3VO3, and protease inhibitor cocktail [leupeptin (0.5 μg/ml ), pepstatin (0.5 μg/ml), and aprotonin (0.5 μg/ml)]} and loaded using SDS loading dye [62.5 mM tris-HCl (pH 6.8), 25% (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) β-mercaptoethanol, and 0.0625% (w/v) bromophenol blue] for gel electrophoresis (SDS–polyacrylamide gel electrophoresis).

Coimmunoprecipitation

Cell lysates were incubated with the antibody of interest (1 to 2 μg) for 1 hour overnight (O/N) at 4°C with gentle rotation. IgA- or IgG-agarose beads (Sigma) were added to the extracts and incubated at 4°C for 1 hour to allow antibody-bead coupling. The beads were washed several times with IP wash buffer [50 mM tris-HCl (pH 7.4), 150 mM NaCl, 0.1% Igepal CA-630/NP-40, 1 mM EDTA, 1 mM NaF, 1 mM Na3VO3, and protease inhibitor cocktail], and the protein complexes bound to the antibody-agarose beads were eluted by adding SDS loading dye.

Luciferase reporter assay

Cells transfected with E2F-1 gene promoter-luciferase construct, E2F-1/PAD4, and β-gal plasmids were lysed with Reporter Lysis Buffer (Promega). Luciferase reporter readings were read and normalized to β-gal assay values {β-gal buffer [0.2 M Na2PO4 (pH 7.2), 2 mM MgCl2, 0.7% β-mercaptoethanol, and 0.44 M ortho-nitrophenyl-β-galactopyranoside]}.

Chromatin immunoprecipitation